|
ATCC
caption a7 organism phylum identity Caption A7 Organism Phylum Identity, supplied by ATCC, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/caption a7 organism phylum identity/product/ATCC Average 96 stars, based on 1 article reviews
caption a7 organism phylum identity - by Bioz Stars,
2026-02
96/100 stars
|
Buy from Supplier |
|
Thermo Fisher
caption a7 source organism unknown dna source unknown forward primer † gene specific att b1 primer ![]() Caption A7 Source Organism Unknown Dna Source Unknown Forward Primer † Gene Specific Att B1 Primer, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/caption a7 source organism unknown dna source unknown forward primer † gene specific att b1 primer/product/Thermo Fisher Average 99 stars, based on 1 article reviews
caption a7 source organism unknown dna source unknown forward primer † gene specific att b1 primer - by Bioz Stars,
2026-02
99/100 stars
|
Buy from Supplier |
|
ATCC
caption a7 source organism j denitrificans strain atcc 14870 dna source synthetic dna forward primer 5 ccgtagcaat ggatcc atgaagaagagaaagttgagagcgtcagc ![]() Caption A7 Source Organism J Denitrificans Strain Atcc 14870 Dna Source Synthetic Dna Forward Primer 5 Ccgtagcaat Ggatcc Atgaagaagagaaagttgagagcgtcagc, supplied by ATCC, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/caption a7 source organism j denitrificans strain atcc 14870 dna source synthetic dna forward primer 5 ccgtagcaat ggatcc atgaagaagagaaagttgagagcgtcagc/product/ATCC Average 93 stars, based on 1 article reviews
caption a7 source organism j denitrificans strain atcc 14870 dna source synthetic dna forward primer 5 ccgtagcaat ggatcc atgaagaagagaaagttgagagcgtcagc - by Bioz Stars,
2026-02
93/100 stars
|
Buy from Supplier |
|
ATCC
t5 caption a7 test organism mic ic 50 sem ![]() T5 Caption A7 Test Organism Mic Ic 50 Sem, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/t5 caption a7 test organism mic ic 50 sem/product/ATCC Average 99 stars, based on 1 article reviews
t5 caption a7 test organism mic ic 50 sem - by Bioz Stars,
2026-02
99/100 stars
|
Buy from Supplier |
|
ATCC
caption a7 source organism s mutans dna source s mutans strain ua159 ![]() Caption A7 Source Organism S Mutans Dna Source S Mutans Strain Ua159, supplied by ATCC, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/caption a7 source organism s mutans dna source s mutans strain ua159/product/ATCC Average 98 stars, based on 1 article reviews
caption a7 source organism s mutans dna source s mutans strain ua159 - by Bioz Stars,
2026-02
98/100 stars
|
Buy from Supplier |
|
ATCC
caption a7 organism atcc no ![]() Caption A7 Organism Atcc No, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/caption a7 organism atcc no/product/ATCC Average 99 stars, based on 1 article reviews
caption a7 organism atcc no - by Bioz Stars,
2026-02
99/100 stars
|
Buy from Supplier |
|
ATCC
caption a7 organism antifungal agent mic range ![]() Caption A7 Organism Antifungal Agent Mic Range, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/caption a7 organism antifungal agent mic range/product/ATCC Average 99 stars, based on 1 article reviews
caption a7 organism antifungal agent mic range - by Bioz Stars,
2026-02
99/100 stars
|
Buy from Supplier |
|
Signal Recovery
whole-organ mean signal recovery ![]() Whole Organ Mean Signal Recovery, supplied by Signal Recovery, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/whole-organ mean signal recovery/product/Signal Recovery Average 90 stars, based on 1 article reviews
whole-organ mean signal recovery - by Bioz Stars,
2026-02
90/100 stars
|
Buy from Supplier |
|
ATCC
caption a7 organism amp lib 16a 17a l7b s aureus atcc 29213 sensitive 4 128 128 128 128 s aureus nctc 12493 mec a resistant ![]() Caption A7 Organism Amp Lib 16a 17a L7b S Aureus Atcc 29213 Sensitive 4 128 128 128 128 S Aureus Nctc 12493 Mec A Resistant, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/caption a7 organism amp lib 16a 17a l7b s aureus atcc 29213 sensitive 4 128 128 128 128 s aureus nctc 12493 mec a resistant/product/ATCC Average 99 stars, based on 1 article reviews
caption a7 organism amp lib 16a 17a l7b s aureus atcc 29213 sensitive 4 128 128 128 128 s aureus nctc 12493 mec a resistant - by Bioz Stars,
2026-02
99/100 stars
|
Buy from Supplier |
|
GenScript corporation
dna source synthesized ![]() Dna Source Synthesized, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/dna source synthesized/product/GenScript corporation Average 90 stars, based on 1 article reviews
dna source synthesized - by Bioz Stars,
2026-02
90/100 stars
|
Buy from Supplier |
|
ATCC
caption a7 mycoplasma sp ![]() Caption A7 Mycoplasma Sp, supplied by ATCC, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/caption a7 mycoplasma sp/product/ATCC Average 94 stars, based on 1 article reviews
caption a7 mycoplasma sp - by Bioz Stars,
2026-02
94/100 stars
|
Buy from Supplier |
|
ATCC
caption a7 organism smtb arsr synonym α3 ![]() Caption A7 Organism Smtb Arsr Synonym α3, supplied by ATCC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/caption a7 organism smtb arsr synonym α3/product/ATCC Average 90 stars, based on 1 article reviews
caption a7 organism smtb arsr synonym α3 - by Bioz Stars,
2026-02
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Acta Crystallographica. Section F, Structural Biology Communications
Article Title: The structure of a glycoside hydrolase 29 family member from a rumen bacterium reveals unique, dual carbohydrate-binding domains
doi: 10.1107/S2053230X16014072
Figure Lengend Snippet: Macromolecule-production information
Article Snippet: The protein was concentrated (at room temperature) using a 10 kDa molecular-weight cutoff ultrafiltration centrifugation column (Sartorius, Germany), further purified by gel filtration on a S200 16/60 size-exclusion column (GE Healthcare, Germany) in 50 m M Tris pH 7.5, 100 m M NaCl buffer and concentrated. table ft1 table-wrap mode="anchored" t5 Table 1
Techniques: Clone Assay, Plasmid Preparation, Expressing, Sequencing, Construct, Produced
Journal: Acta Crystallographica. Section F, Structural Biology Communications
Article Title: Neutron and high-resolution room-temperature X-ray data collection from crystallized lytic polysaccharide monooxygenase
doi: 10.1107/S2053230X15019743
Figure Lengend Snippet: Macromolecule-production information
Article Snippet: Details of the cloning and protein-production procedures are summarized in Table 1 . table ft1 table-wrap mode="anchored" t5 Table 1
Techniques: Expressing, Plasmid Preparation, Sequencing, Construct, Produced
Journal: Acta Crystallographica. Section F, Structural Biology Communications
Article Title: Crystal structure of the aromatic-amino-acid aminotransferase from Streptococcus mutans
doi: 10.1107/S2053230X18018472
Figure Lengend Snippet: Macromolecule-production information
Article Snippet: Macromolecule-production information is summarized in Table 1 . table ft1 table-wrap mode="anchored" t5 Table 1
Techniques: Cloning, Plasmid Preparation, Expressing, Sequencing, Construct, Produced
Journal: Molecular imaging and biology
Article Title: The Impact of Positron Range on PET Resolution, Evaluated with Phantoms and PHITS Monte Carlo Simulations for Conventional and Non-conventional Radionuclides
doi: 10.1007/s11307-019-01337-2
Figure Lengend Snippet: Simulation organ volumes, organ uptake values from Holland et al. used in simulations, and corresponding organ-level mean signal recovery in the modified Digimouse phantom, for different radionuclides
Article Snippet: Note in particular the poor quantitative accuracy provided by Ga-68 and As-72 for small structures, e.g ., tumor, spleen. table ft1 table-wrap mode="anchored" t5 Table 4. caption a7 Source tissue Source %ID/cc Volume (
Techniques: Modification
Journal:
Article Title: Identification of SmtB/ArsR cis elements and proteins in archaea using the Prokaryotic InterGenic Exploration Database (PIGED)
doi:
Figure Lengend Snippet: Chromosomal signature of SmtB/ArsR and regulons based on predicted operator sequences.
Article Snippet: Intergenic and whole genome sequences were scanned at PIGED using scoring matrices derived from both 6-2-6 and 12-2-12 versions of these 60 predicted operator sequences to ensure a complete data set from this analysis. table ft1 table-wrap mode="anchored" t5 Table 1.
Techniques:
Journal:
Article Title: Identification of SmtB/ArsR cis elements and proteins in archaea using the Prokaryotic InterGenic Exploration Database (PIGED)
doi:
Figure Lengend Snippet: Signature sequences for SmtB/ArsR protein-DNA interactions. WebLogo (Crooks et al. 2004) was used to generate consensus profiles for (A) sixty SmtB/ArsR operator sites identified in this study and (B) forty-three amino acid sequences comprising the winged helix-turn-helix DNA binding motif of predicted autoregulatory SmtB/ArsR proteins. Secondary structural elements of the DNA binding motif are shown beneath the respective amino acid sequences comprising the alpha helices and beta sheets. αR represents the recognition helix of the DNA binding motif.
Article Snippet: Intergenic and whole genome sequences were scanned at PIGED using scoring matrices derived from both 6-2-6 and 12-2-12 versions of these 60 predicted operator sequences to ensure a complete data set from this analysis. table ft1 table-wrap mode="anchored" t5 Table 1.
Techniques: Binding Assay
Journal:
Article Title: Identification of SmtB/ArsR cis elements and proteins in archaea using the Prokaryotic InterGenic Exploration Database (PIGED)
doi:
Figure Lengend Snippet: Phylogeny of SmtB/ArsR/CadC family proteins. Amino acid sequences for SmtB/ArsR proteins containing the DNA recognition signature, together with MerR from Streptomyces lividans (Brunker et al. 1996) and other characterized ArsR and CadC proteins were used to reconstruct a previous phylogenetic tree describing relationships among ArsR, SmtB, and CadC proteins (Busenlehner 2003). All amino acid sequences contain DNA recognition signatures except those listed as ARSR, MERR, or CADC. Neighboring joining analysis, bootstrapping, and tree visualization were performed using the MEGA3 software package (Kumar et al. 2004). A solid circle at a node indicates the level of bootstrap support is > 50%, while scale refers to p-distance value estimates. Synonyms for archaeal sequences are boxed. VNG7125 shares significant sequence similarity with other ArsR pro teins, but is separated from this partition because of an apparent 22 N-terminal amino acid extension that could be the result of misannotation regarding the translational start site. Unlisted synonyms have been collapsed into families based on their identical or near-identical sequences. The CZRA S. aureus str. grouping includes SACOL2137, SAR2233, SAV2145, SA1947, SAS2048, and MW2069. The Bacillus sp. grouping includes B. anthracis (GBAA0594, BA0594, BAS0563), B. cereus (BCZK0507, BCE0662, BC0595), and B. thuringiensis (BT9727-0505). The NmtR Mycobacterium sp. grouping includes (RV3744, Mb3770, MT3852). For synonym–organism relationships, consult Table 1.
Article Snippet: Intergenic and whole genome sequences were scanned at PIGED using scoring matrices derived from both 6-2-6 and 12-2-12 versions of these 60 predicted operator sequences to ensure a complete data set from this analysis. table ft1 table-wrap mode="anchored" t5 Table 1.
Techniques: Software, Sequencing